INTRODUCTION:

Oral cancer is a serious condition which affects various tissues in the mouth, such as the tongue, lips, gums, hard palate, retromolar trigone, and the sublingual surface. It is 16^th most common cancer among the most frequently diagnosed cancers globally.¹

Oral squamous cell carcinoma is the most common type of cancer, with tobacco and alcohol consumption playing significant roles as risk factors.² The prevalence of oral cancer has been steadily increasing over the years, with projection indicating a significant rise of 30 percent by the year 2030.³ This concerning trend emphasises the need for more awareness, early identification, and efficient treatment strategies. At present, radiation therapy, surgery, and systemic therapies like chemotherapy and immunotherapy are used for treating oral cancer.⁴ Recent developments in chemotherapy for oral cancer have broadened treatment options and improved patients’ outcome.⁵ Particularly in palliative care, chemotherapy has gained popularity due to its convenience.⁶ Immunotherapy like programmed cell death-ligand 1 inhibitor, has recently shown promise in managing advanced disease.⁷ However, chemotherapy can cause side effects such as delays in tissue healing and damage in salivary gland.^5,7,8,9 With respect to oral cancer, chemotherapy resistance is still a major concern that reduces treatment effectiveness and has a negative impact on patient outcomes.^10,11 Multiple mechanisms contribute resistance, including drug efflux, apoptosis evasion, DNA repair, and epithelial-mesenchymal transition.^10,14 Ongoing research focuses on developing strategies to overcome chemoresistance and improve treatment efficacy by finding new therapeutic compounds.^{12,13,14,15,16}

Sesame (Sesamum indicum) belongs to the family of Pedaliaceae, and is a significant oilseed that has been utilized by humans for its nutritional and therapeutic benefits for a very long time.¹⁷ Sesamol (3,4-methylene-dioxyphenol or 5-hydroxy-1,3-benzodioxole), a phenolic compound is extracted from roasted sesame seeds and processed sesame oil.¹⁸ Sesamol exhibits a wide range of therapeutic effects against neurodegenerative diseases, metabolic disorders, and inflammation. Additionally, sesamol shows hepatoprotective, antimicrobial, anticancer, antioxidant, antimicrobial, chemoprevention, and antimutagenic properties by influencing various molecular pathway.^19,20 It alleviates Alzheimer’s, Huntington's, and Parkinson's diseases by improving redox imbalance and reducing inflammatory markers.²¹ Its hypolipidemic effects are attributed to its influence on lipid metabolism and cholesterol regulation.²² Cytotoxicity and apoptosis inducing potential of sesamol have been demonstrated in vitro experiments conducted on human lung, colon, and liver cancer cells.^23,24,25,23 In light of the above studies, sesamol may be useful in treating a variety of illnesses and acting as a cytotoxic agent.²⁶Overall, multifaceted pharmacological activities of sesamol suggest that, sesamol could be a potential natural anticancer compound, warranting detailed investigation to optimize its clinical applications. In view of this information, the purpose of this study was to assess the cytotoxic efficacy of sesamol on KB cells.

METHODS AND MATERIALS:

Chemicals and reagents:

Sesamol was acquired from Sigma Chemicals, Chennai, India. Cell culture supplies including Dulbecco’s minimum-low glucose medium (DMEM), antibiotics, trypsin-EDTA, fetal bovine serum (FBS) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were procured from GIBCO BRL. Other chemicals were bought locally and used in different assays.

Cell culture:

KB cell line, a subline of the ubiquitous KERATIN-forming tumor cell line HeLa, was obtained from NCCS, Pune, India and cultured at 37^oC with 5% CO₂. The cells were cultured in DMEM containing 10% FBS, penicillin (100 units/mL), and streptomycin (100 μg/mL). KB cells were exposed to varying concentrations of sesamol for 24 hrs. Untreated-KB cells and cells treated with cisplatin served as control and positive control, respectively.

MTT assay:

For MTT assay, 85, 175, 350, 700, 1400 and 2800 μM/ml of sesamol was exposed to KB cells. After 24 hours of treatment, MTT reagent was used to replace the media. The purple-blue crystalline formazan was dissolved in DMSO following a 4-hour incubation period at 37°C. The intensity of the colour was determined at 570 nm. Changes in cellular morphology were microscopically examined. Depending on the IC₅₀value, KB cells were treated with 350, 700, 1400 μM/ml of sesamol for the following experiments.

4′,6-diamidino-2-phenylindole (DAPI) staining:

DAPI staining was done to assess the apoptotic changes in KB cells. Control, sesamol and cisplatin treated cells (2 × 10⁵/well) seeded in 6-well plates were fixed with 4% paraformaldehyde and then treated with DAPI stain in dark. The cells were incubated for 10 min at room temperature, and were examined using a fluorescent microscope (Invitrogen, EVOS) at an emission of 365-375 nm.

Semi-quantitative PCR:

RNAiso plus reagent (TaKaRa, India) was used to isolate the RNA from the treated cells. Using the PrimeScript first-strand cDNA synthesis Kit (TaKaRa, India), 2 μg of RNA was reverse transcribed to cDNA after its purity was confirmed. Semi-quantitative PCR was performed using the cDNA as template. Respective primers for antioxidant genes such as superoxide dismutase (SOD) (Forward: CAGTGCAGGGCATCATCAAT; Reverse: CATTGCCCAAGTCTCCAACA) and glutathione peroxidase (Gpx) (Forward: ATGAACGAGCTGCAGCGGCGC; Reverse: CTAGGCACAGCTGGGCCCTTG) and β-actin (Forward: GTGGGCCGCTCTAGGCACCA; Reverse: CTCTTTGATGTCACGCACGATTTC) (Synergy, Chennai, India) were used. Genes were amplified in T100 Thermal cycler (Bio-Rad, California, USA). After that, a 1.5% agarose gel was used for electrophoresis of the PCR products. The bands were observed under gel documentation system (VilberLourmat, France) and the band intensity was quantified by ImageJ software (1.49v).

Quantitative real time PCR:

Relative mRNA expression of apoptosis related marker genes was analyzed by qRT-PCR. Specific primers for apoptotic genes Bax (Forward: 5’-GGTGCCTCAGGATGCG-3’; Reverse: 5’-GGAGTCTGTGTCCACG-3’), Bcl-2 (Forward: 5’- TTGGCCCCCGTTGCTT -3’; Reverse: 5’- CGGTTATCGTACCCCGTTCTC -3’), cytochrome c (Forward: 5’-CAACTTTTCACAAAGATGGTGAGTG-3’; apoptotic protease activating factor-1 (Apaf-1) (Forward: 5’-GTCTGCTGATGGTGCAAGGA-3’; Reverse: 5’-GATGGCCCGTGTGGATTTC-3’) and housekeeping gene GAPDH (Forward: 5’-GAAATCCCATCACCATCTTCC-3’; Reverse: 5’-AAATGAGCCCCAGCCTTCTC-3’) were chosen for the gene amplification. An RT-qPCR CFX 96-C1000 Thermal cycler (Bio-Rad, California, USA) was used to amplify the target gene. After obtaining Ct values, the 2 −ΔΔCt formula was used to determine the relative fold change between gene expression. The expression of the target gene was normalised using GAPDH.

Statistical analysis:

The results were expressed as mean±S.E.M. Dunnett's test and one-way ANOVA were used to assess statistical significance; a p-value of less than 0.05 was considered significant.

RESULTS:

The cytotoxic effects of sesamol on KB cells:

Both cell viability and growth rates were assessed using the MTT assay. It was found that as the concentration of sesamol increased, the KB cells viability decreased. The KB cells were exposed to concentrations of sesamol at 85, 175, 350, 700, 1400, and 2800µM for 24hours. Sesamol treatment resulted in a notable decrease in cell viability after 24hours, demonstrating a concentration-dependent effect, with results indicating significant statistical differences. There was no significant viability reduction at 85µM/ml. The significant (p<0.01) viability reduction started at 175µM/mL. The highest level of inhibition in cell viability occurred from 350 to 2800 µM/mL (p<0.001) of sesamol treatment. The IC₅₀ value for sesamol was identified to be 700µM/ml. Thus, for the following experiments, KB cells were treated with 350, 700, and 1400µM/mL of sesamol (Figure 1).

Figure 1. Sesamol induced cytotoxic effect on KB cells. Cell viability was assessed using the MTT assay after cells were treated with sesamol (350–1400 µM/ml) for 24hours. Data are shown as means±SD (n = 3). **p < .01 and ***p< .001 compared to control.

Sesamol induced morphological changes on KB cells

After 24 hours of treatment with sesamol at different concentrations (350, 700 and 1400µM/mL) and cisplatin showed significant difference on morphological alterations of KB cells. Upon microscopic observation, sesamol and cisplatin treatment resulted increase in floating cells and reduction in viable cell count, compared with the control group. The morphological analysis clearly demonstrates that KB cells treated with sesamol exhibit reduced cell size, cytoplasmic membrane blebbing, and cell shrinkage. In contrast, the control group showed normal morphology (Figure 2).

Figure 2. Sesamol-induced morphological changes in KB cells. Sesamol (350, 700, and 1400 µM/ml) treated cells were shrunk and showed cytoplasmic membrane blebbing.

Effect of sesamol on the apoptosis-related morphological changes of KB cells:

DAPI staining was used to investigate potential nuclear modifications, such as DNA damage, that can inhibit cell growth. Cells treated with sesamol displayed significant nuclear morphological alterations such as fragmentation, condensation etc., compared with control (Figure 3).

Effect of sesamol on the mRNA expression of antioxidants:

The expression of antioxidant genes SOD and GPx were evaluated by quantitative PCR following treatment with sesamol at varying concentrations (350 and 1400 µM/mL) and compared to both untreated control and cisplatin-treated cells. The significant downregulation of SOD expression was observed at concentration of both 350 and 1400µM/mL (p<0.001). At 700µM, SOD expression was comparable to the control group, suggesting a dose-specific effect. Additionally, all concentration of sesamol upregulates GPx significantly, when compared to control. The notable increase occurred at 350µM/mL (p<0.001) of sesamol and cisplatin treatments, while moderate but significant elevations were seen at 700(p<0.01) and 1400µM/mL (p<0.05)(Figure 4).

Figure 4. Effect of sesamol on oxidative stress markers expression in KB cells by semiquantitative PCR.

Data are shown as means±SD (n = 3). *p<0.05, **p<0.01 and ***p<0.001 compared to control. SOD, superoxide dismutase; GPx, glutathione peroxidase.

Effect of sesamol on the apoptosis-related mRNA expressions:

By using RT-PCR, the expression of apoptosis markers was assessed. The pro-apoptotic gene Bax was significantly upregulated at 350 and 1400µM/mL in sesamol- and cisplatin-treated cells (p<0.001), indicating activation of the mitochondrial apoptotic pathway. Contrastingly, Bcl-2(anti-apoptotic gene) was significantly reduced at 350µM/mL (p<0.05). Although cytochrome c expression showed a non-significant upregulation at all sesamol-treated concentrations, a significant increase was observed at 700µM/mL sesamol (p<0.05) and in the cisplatin treatment groups (p< 0.001). Apaf-1 expression was significantly increased (p <0.001) at moderate (700µM/mL) and high (1400 µM/mL) concentrations, whereas a significant (p< 0.001) downregulation was observed at 350µM/mL and in the cisplatin-treated group (Figure 5). These findings further support that the mitochondrial apoptotic pathway was activated following sesamol treatment in oral cancer KB cells.

Figure 5. Effect of sesamol on apoptotic marker genes expression in KB cells. Sesamol (350, 700, and 1400 µM/ml) treatment altered the gene expression of apoptotic marker.

Data are shown as means±SD (n = 3). *p<0.05 and ***p<0.001 compared to control. Bax, Bcl-2-associated X protein; Bcl-2, B-cell leukemia/lymphoma 2; Apaf-1, apoptotic protease activating factor 1.

DISCUSSION:

Sesamol is recognized as a potent antioxidant and anticancer compound that offers therapeutic advantages in various tumor cells and animal models. It promotes apoptosis via intrinsic and extrinsic pathways, as evidenced by increased caspase activity and depolarization of mitochondrial membrane potential.²⁰ In hepatocellular carcinoma cells, sesamol impairs mitochondrial function, suppresses autophagy, and induces cell cycle arrest.²⁷ Sesamol's anticancer effects involve modulation of multiple signaling pathways, including p53, mitogen-activated protein kinase, and nuclear factor kappa B.²⁶ The cytotoxic effect of sesamol was confirmed by measuring the enzymatic conversion of formazan from MTT, which is connected to absorbance.^28,29,30,31 Decreased absorbance confirmed impaired mitochondrial function and cytotoxic effect of sesamol, possibly mediated via activation of an apoptosis pathway.³² Several studies have reported that sesamol reduced the cell viability of carcinoma cells such as HepG2, HCT116, and SCC-25 cell lines, as assessed by MTT or similar assays.^24,27,³³ Sesamol treatment produced a dose-dependent lose in cell viability indicating its ability to induce the cytotoxicity to the KB cells. In the present study, it was found that sesamol at 700μM/mL induced 50% of cell death. Based on this result, we selected 350, 700 and 1400µM/mL concentrations of sesamol for further study. The anti-proliferative effect of sesamol observed in our study are consistent with previous research demonstrating sesamol's efficacy in inhibiting cancer cell growth. Specifically, Siriwarin & Weerapreeyakul (2016),¹⁷ reported that sesamol exerted anti-proliferative effects in lung adenocarcinoma cells, highlighting its potential as an anti-cancer agent. Our study extends these findings to oral cancer cells, reinforcing sesamol’s role in reducing cancer cell proliferation across different cancer types.

Apoptosis can be differentiated by observation of cell morphology, and DAPI staining. In previous studies, sesamol induces apoptosis in HepG2 liver cancer cells.²⁵ Our study observed that sesamol treatment induced apoptosis in oral cancer cells, as evidenced by nuclear shrinkage, chromatin condensation, and nuclear fragmentation. These morphological changes are indicative of apoptosis and support the link between oxidative stress and programmed cell death.³⁴ Apoptotic pathways in cancer can be triggered by oxidative stress, and sesamol’s ability to induce such stress likely contributes to its pro-apoptotic effects. To further elaborate the insights over the cause of cell death, antioxidant and apoptosis marker gene expressions was evaluated.

In the cancer microenvironment, oxidative stress arises when there is an imbalance between reactive oxygen species (ROS) and antioxidant levels. Oxidative stress and accumulation of ROS can contribute to both cell growth and cell death.³⁵ Sesamol’s anticancer properties are attributed to its potential to induce oxidative stress in cancer cells. Many phytocompounds, including sesamol, act by disrupting the balance between oxidative and antioxidative mechanisms within cancer cells.^36,37,38 Several previous studies have demonstrated that sesamol can act as a pro-oxidant in cancer cells. For instance, Liu et al. (2017) showed that sesamol caused a dose-dependent elevation of ROS and loss of viability in HepG2 cells.²⁶ Similarly, Ezhilarasan et al. (2021) reported that sesamol treatment in SCC-25 cells significantly increased intracellular ROS, induced mitochondrial membrane depolarization, and activated caspase-3, leading to apoptosis.²⁷Ali et al., (2021) observed sesamol induced ROS production in a dose-dependent manner in parasites.³⁹ In our study, we evaluate the mRNA expression of genes encoding antioxidant enzymes GPx and SOD in response to sesamol treatment. Superoxide radicals are converted to hydrogen peroxide by SOD, which is subsequently broken down by glutathione to produce water, as part of the antioxidant defence system's regulation of ROS in cells.^37,40 Our findings indicate, sesamol treatment at 350 and 1400 concentration led to downregulate the expression of SOD, suggesting an impaired superoxide clearance. Although the upregulation of GPx, particularly at 350µM indicating an adaptive response to detoxify hydrogen peroxide. These results may reflect a disruption in the antioxidant defence system, potentially promotes the accumulation of ROS and induction of apoptosis.^41,42 This may lead to excessive oxidative stress, mitochondrial dysfunction, and the activation of apoptosis pathways, indicating sesamol's pro-oxidant potential as an anticancer agent.⁴³ To explore the apoptosis mechanism we investigated apoptosis related marker genes in KB cells after the treatment. Treatment with sesamol led to an alteration in apoptosis marker gene expression in KB cells. We observed an increased expression of Bax and cytochrome C expression, along with decreased expression of Bcl-2 genes. These results indicating that sesamol induces the activation of the intrinsic (mitochondrial) apoptotic pathway.⁴³ The redox imbalance in KB cell line after the treatment with sesamol, appears to act as a pro-apoptotic signal, as demonstrated by decrease in Bcl-2 and increased in Bax expression.⁴⁴ These results suggesting that the elevated expressions facilitate permeabilization of mitochondrial outer membrane, which releases cytochrome c into the cytosol.⁴⁵ Consistently, our data show increased expression of cytochrome c and apaf-1 further supporting apoptosome formation and caspase activation. Previous studies sesamol at higher concentration has a pro-oxidant effect on human colon cancer HCT116 cells by inducing the mitochondrial apoptosis.²⁹ Sesamol’s cytotoxicity correlates with elevated ROS and apoptotic markers, supporting a pro-oxidant/mitochondrial mode of action at cytotoxic concentrations. Similar to Khamphio et al. (2016)²⁹, this study also indicates that sesamol acts as a pro-oxidant, and lead to impaired ROS-scavenging capacity and induction of oxidative stress in KB oral cancer cells. Our study’s findings suggest that sesamol treatment leads to a decrease in these antioxidants, thereby increasing oxidative stress and contributing to its anti-cancer effects.

This study demonstrates cytotoxic potential of sesamol in KB cells. However, our study has following limitations. These findings are derived from a single cell line model and therefore, future research should include multiple oral cancer cell lines. Additionally, sesamol should be studied using a cancer model in vivo. Furthermore, investigating the effects of sesamol in combination with existing chemotherapeutics or targeted agents may reveal potential synergistic interactions that could enhance therapeutic efficacy.

CONCLUSION:

In conclusion, our study demonstrates that sesamol exerts significant pro-apoptotic effects and anti-proliferative in KB cells. The compound disrupts the redox homeostasis by modulating antioxidant genes. This oxidative imbalance correlates with the induction of mitochondrial-mediated apoptosis, as illustrated by the upregulated expression of Bax, Apaf-1, and cytochrome c, and the downregulated expression of Bcl-2 expression. These findings provide a basis for future studies to investigate sesamol's mechanisms in greater detail and its potential for clinical applications in cancer therapy.

CONFLICT OF INTEREST:

The authors hereby declare that there is no conflict of interest in this study.

REFERENCES:

1. Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, Jemal A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024; 74(3): 229-263. doi: 10.3322/caac.21834.

2. Kijowska J, Grzegorczyk J, Gliwa K, Jędras A, Sitarz M. Epidemiology, Diagnostics, and Therapy of Oral Cancer-Update Review. Cancers (Basel). 2024; 16(18): 3156. doi: 10.3390/cancers16183156.

3. Johnson DE, Burtness B, Leemans CR, Lui VWY, Bauman JE, Grandis JR. Head and neck squamous cell carcinoma. Nat Rev Dis Primers. 2020; 6(1): 92. doi: 10.1038/s41572-023-00418-5.

4. Horn D, Zittel S, Moratin J, Metzger K, Ristow O, Krisam J, Bodem J, Engel M, Freudlsperger C, Hoffmann J, Freier K. Prospective feasibility analysis of salvage surgery in recurrent oral cancer in terms of quality of life. Oral Oncol. 2020; 102: 104580. doi: 10.1016/j.oraloncology.2020.104580.

5. Shah R, Shah H, Thakkar K, Parikh N. Conventional Therapies of Oral Cancers: Highlights on Chemotherapeutic Agents and Radiotherapy, Their Adverse Effects, and the Cost Burden of Conventional Therapies. Crit Rev Oncog. 2023; 28(2): 1-10. doi: 10.1615/CritRevOncog.2023046835.

6. O'Neill VJ, Twelves CJ. Oral cancer treatment: developments in chemotherapy and beyond. Br J Cancer. 2002; 87(9): 933-7. doi: 10.1038/sj.bjc.6600591.

7. Huang SH, O'Sullivan B. Oral cancer: Current role of radiotherapy and chemotherapy. Med Oral Patol Oral Cir Bucal. 2013; 18(2): e233-40. doi: 10.4317/medoral.18772.

8. Nguyen TV, Chiu KC, Shih YH, Liu CJ, Bao Quach TV, Hsia SM, Chen YH, Shieh TM. Protective Effect of Electroacupuncture on Chemotherapy-Induced Salivary Gland Hypofunction in a Mouse Model. Int J Mol Sci. 2023; 24(14): 11654. doi: 10.3390/ijms241411654.

9. Wang C, Liu XQ, Hou JS, Wang JN, Huang HZ. Molecular Mechanisms of Chemoresistance in Oral Cancer. Chin J Dent Res. 2016; 19(1): 25-33. doi: 10.3290/j.cjdr.a35694.

10. Khan SU, Fatima K, Aisha S, Malik F. Unveiling the mechanisms and challenges of cancer drug resistance. Cell Commun Signal. 2024; 22(1): 109. doi: 10.1186/s12964-023-01302-1

11. Sha J, Bai Y, Ngo HX, Okui T, Kanno T. Overview of Evidence-Based Chemotherapy for Oral Cancer: Focus on Drug Resistance Related to the Epithelial-Mesenchymal Transition. Biomolecules. 2021;11(6):893. doi: 10.3390/biom11060893.

12. Easwaran M, Madasamy S, Venkidasamy B. Theranostic Potential of Bacteriophages against Oral Squamous Cell Carcinoma. Curr Gene Ther. 2025;25(2):89-91.

13. Roy A, Cheriyan BV, Perumal E, Rengasamy KR, Anandakumar S. Effect of hinokitiol in ameliorating oral cancer: in vitro and in silico evidences. Odontology. 2025;113(2):750-763.

14. Senthil R. Bevacizumab-Conjugated Curcumin Nanoparticles Promote Cytotoxicity and Apoptosis in Human Malignant Oral Keratinocytes In Vitro. J Oral Maxillofac Surg. 2025:S0278-2391(25)00319-2. doi: 10.1016/j.joms.2025.05.014.

15. Vidhya Rekha U, Prabhu MN, Bhuminathan S. Review on anticancer properties of piperine in oral cancer: therapeutic perspectives. Res J Pharm Technol. 2022;15(7):3338-42. doi:10.52711/0974-360X.2022.00558.

16. Bhavikatti SK, Zainuddin SLA, Ramli RB, Nadaf SJ, Dandge PB, Khalate M, Karobari MI. Insights into the antioxidant, anti-inflammatory and anti-microbial potential of Nigella sativa essential oil against oral pathogens. Sci Rep. 2024;14(1):11878. doi: 10.1038/s41598-024-62915-1.

17. Siriwarin B, Weerapreeyakul N. Sesamol induced apoptotic effect in lung adenocarcinoma cells through both intrinsic and extrinsic pathways. Chem Biol Interact. 2016; 254: 109-16. doi: 10.1016/j.cbi.2016.06.001.

18. Bosebabu B, Cheruku SP, Chamallamudi MR, Nampoothiri M, Shenoy RR, Nandakumar K, Parihar VK, Kumar N. An Appraisal of Current Pharmacological Perspectives of Sesamol: A Review. Mini Rev Med Chem. 2020; 20(11): 988-1000. doi: 10.2174/1389557520666200313120419.

19. Zhou S, Zou H, Huang G, Chen G. Preparations and antioxidant activities of sesamol and it's derivatives. Bioorg Med Chem Lett. 2021; 31: 127716. doi: 10.1016/j.bmcl.2020.127716.

20. Ruankham W, Suwanjang W, Wongchitrat P, Prachayasittikul V, Prachayasittikul S, Phopin K. Sesamin and sesamol attenuate H2O2-induced oxidative stress on human neuronal cells via the SIRT1-SIRT3-FOXO3a signaling pathway. Nutr Neurosci. 2021; 24(2): 90-101. doi: 10.1080/1028415X.2019.1596613.

21. Majdalawieh AF, Eltayeb AE, Abu-Yousef IA, Yousef SM. Hypolipidemic and Anti-Atherogenic Effects of Sesamol and Possible Mechanisms of Action: A Comprehensive Review. Molecules. 2023; 28(8): 3567. doi: 10.3390/molecules28083567.

22. Thushara RM, Hemshekhar M, Sunitha K, Kumar MS, Naveen S, Kemparaju K, Girish KS. Sesamol induces apoptosis in human platelets via reactive oxygen species-mediated mitochondrial damage. Biochimie. 2013; 95(11): 2060-8. doi: 10.1016/j.biochi.2013.07.032.

23. Srisongkram T, Weerapreeyakul N. Route of intracellular uptake and cytotoxicity of sesamol, sesamin, and sesamolin in human melanoma SK-MEL-2 cells. Biomed Pharmacother. 2022; 146: 112528. doi: 10.1016/j.biopha.2021.112528.

24. Liu Z, Xiang Q, Du L, Song G, Wang Y, Liu X. The interaction of sesamol with DNA and cytotoxicity, apoptosis, and localization in HepG2 cells. Food Chem. 2013; 141(1): 289-96. doi: 10.1016/j.foodchem.2013.02.105.

25. Majdalawieh AF, Mansour ZR. Sesamol, a major lignan in sesame seeds (Sesamum indicum): Anti-cancer properties and mechanisms of action. Eur J Pharmacol. 2019; 855: 75-89. doi: 10.1016/j.ejphar.2019.05.008.

26. Liu Z, Ren B, Wang Y, Zou C, Qiao Q, Diao Z, Mi Y, Zhu D, Liu X. Sesamol Induces Human Hepatocellular Carcinoma Cells Apoptosis by Impairing Mitochondrial Function and Suppressing Autophagy. Sci Rep. 2017; 7: 45728. doi: 10.1038/srep45728.

27. Ezhilarasan D, Ali D, Varghese R. Sesamol induces cytotoxicity via mitochondrial apoptosis in SCC-25 cells. Hum Exp Toxicol. 2021 D; 40(12_suppl): S423-S433. doi: 10.1177/09603271211047926.

28. Sathish Kumar M, Vijey Aanandhi M. Design, Molecular docking, Synthesis and Biological evaluation of 5, 7 dimethyl pyrido(2, 3-d)pyrimidin-4-one and 4,5 dihydro pyrazolo (3, 4-d) pyrimidines for cytotoxic activity. Res J Pharm Technol. 2021; 14(6): 3029-8. doi: 10.52711/0974-360X.2021.00530.

29. Ravichandar R, Elango A. Cytotoxic effect of Imeglimin on T47D and MDA-MB-231 cell Lines of Human Breast Cancer – An In-vitro study. Res J Pharm Technol. 2024; 17(9): 4149-3. doi: 10.52711/0974-360X.2024.00642.

30. Nizar A, Ravindran R, Palani J, Nripan T, Asha SD, Pynadath MK. Anticancer Effects of Ethanolic Extracts of Macaranga Peltata Leaves on Human Oral Squamous Carcinoma Cell Lines: An In Vitro Study. J Pharm Bioallied Sci. 2024; 16(Suppl 2):S1833-S1837. doi: 10.4103/jpbs.jpbs_28_24.

31. Tesfaye D, Endale M, Ramachandran VP, Getaneh E, Amenu G, Guta L, Demissie TB, Ombito JO, Eswaramoorthy R, Melaku Y. Antibacterial and Cytotoxicity of Extracts and Isolated Compounds from Artemisia abyssinica: A Combined Experimental and Computational Study. ACS Omega. 2024;9(29):31508-31520. doi: 10.1021/acsomega.4c01096.

32. Jayaraman S, Natararaj S, Veeraraghavan VP. Hesperidin Inhibits Oral Cancer Cell Growth via Apoptosis and Inflammatory Signaling-Mediated Mechanisms: Evidence From In Vitro and In Silico Analyses. Cureus. 2024; 16(2): e53458. doi: 10.7759/cureus.53458.

33. Khamphio M, Barusrux S, Weerapreeyakul N. Sesamol induces mitochondrial apoptosis pathway in HCT116 human colon cancer cells via pro-oxidant effect. Life Sci. 2016; 158: 46-56. doi: 10.1016/j.lfs.2016.06.017.

34. Sahoo BM, Banik BK, Borah P, Jain A. Reactive Oxygen Species (ROS): Key Components in Cancer Therapies. Anticancer Agents. Med Chem. 2022; 22(2): 215-222. doi: 10.2174/1871520621666210608095512.

35. Rahal A, Kumar A, Singh V, Yadav B, Tiwari R, Chakraborty S, Dhama K. Oxidative stress, prooxidants, and antioxidants: the interplay. Biomed Res Int. 2014; 2014: 761264. doi: 10.1155/2014/761264.

36. Prabha SB, Mohini Rao, Ramesh Kumar MR. Evaluation of in vitro Antioxidant, Antibacterial and Anticancer activities of leaf extracts of Cleome rutidosperma. Res J Pharm Technol. 2017; 10(8): 2492-2496. doi: 10.5958/0974-360X.2017.00440.1.

37. Reshma Thirunavakarasu, Antioxidants and Oral Cancer - A Review. Res J Pharm Technol. 2016; 9(8): 1287-1290. doi: 10.5958/0974-360X.2016.00244.4

38. Halliwell B. Establishing the significance and optimal intake of dietary antioxidants: the biomarker concept. Nutr Rev. 1999; 57(4): 104-13. doi: 10.1111/j.1753-4887.1999.tb06933.x.

39. Ali R, Tabrez S, Akand SK, Rahman F, Husein A, Arish M, Alqahtani AS, Ahmed MZ, Husain M, Rub A. Sesamol Induces Apoptosis-Like Cell Death in Leishmania donovani. Front Cell Infect Microbiol. 2021; 11: 749420. doi: 10.3389/fcimb.2021.749420.

40. Jomova K, Alomar SY, Alwasel SH, Nepovimova E, Kuca K, Valko M. Several lines of antioxidant defense against oxidative stress: antioxidant enzymes, nanomaterials with multiple enzyme-mimicking activities, and low-molecular-weight antioxidants. Arch Toxicol. 2024; 98(5): 1323-1367. doi: 10.1007/s00204-024-03696-4.

41. Behl C, Davis JB, Lesley R, Schubert D. Hydrogen peroxide mediates amyloid beta protein toxicity. Cell. 1994; 77(6): 817-27. doi: 10.1016/0092-8674(94)90131-7.

42. Muralidharan K, Kumaravelu P, David DC. Cytotoxic effect of ethanolic extracts of Andrographis echioides in human colon cancer cell lines via apoptosis. Res J Pharm Technol. 2020; 13(2): 871-6. doi:10.5958/0974-360X.2020.00165.1.

43. Martin-Cordero C, Leon-Gonzalez AJ, Calderon-Montano JM, Burgos-Moron E, Lopez-Lazaro M. Pro-oxidant natural products as anticancer agents. Curr Drug Targets. 2012; 13(8): 1006-28.

44. Gheena S, Ezhilarasan D. Syringic acid triggers reactive oxygen species-mediated cytotoxicity in HepG2 cells. Hum Exp Toxicol. 2019; 38(6): 694-702. doi: 10.1177/0960327119839173.

45. Lakshmi T, Ezhilarasan D, Vijayaragavan R, Bhullar SK, Rajendran R. Acacia catechu ethanolic bark extract induces apoptosis in human oral squamous carcinoma cells. J Adv Pharm Technol Res. 2017; 8(4): 143-149. doi: 10.4103/japtr.JAPTR_73_17.

Received on 17.06.2025 Revised on 14.10.2025

Accepted on 13.12.2025 Published on 01.07.2026

Available online from July 04, 2026

Research J. Pharmacy and Technology. 2026;19(7):3030-3036.

DOI: 10.52711/0974-360X.2026.00431

This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License. Creative Commons License.